Meniu
Asmeninė anketa Prisijungimas ir registracija
Atgal Pagrindinis » Medicinos Naujienos » 2022 » Vasario » 26

Naujas tyrimas įrodo, kad "Pfizer" mRNA vakcina visam laikui pakeičia žmogaus DNR

Daugiau nei metus mūsų patikimi "sveikatos ekspertai ir faktų tikrintojai" mums teigė, kad mRNA vakcinos, įskaitant "Pfizer" ir "Moderna", neintegruojasi į žmogaus ląstelių DNR. Tačiau naujasis tyrimas, paskelbtas žurnale "Current Issues of Molecular Biology", rodo, kad sveikatos ekspertai ir faktų tikrintojai klydo.

Laboratoriniai tyrimai rodo, kad mRNA vakcinos PRIVALO integruotis į žmogaus ląstelių DNR. Iš esmės vakcinos visiems laikams pakeičia jūsų DNR.

vakcinos, mRNA vakcinos, DNR

Jame sakoma: laboratoriniai tyrimai rodo, kad mRNA vakcinos DRAUDŽIA integruotis į žmogaus ląstelių DNR. Tai reiškia, kad "Pfizer" vakcinos injekcija, suleista net vieną kartą, visam laikui pakeičia paveiktų ląstelių DNR.

Pagrindinė žiniasklaida ir faktų tikrintojai pasišventę mums teigti priešingai:

vakcinos, mRNA vakcinos, DNR

Tačiau iš "Current Issues of Molecular Biology" straipsnio matyti, kad jie visą laiką skleidė dezinformaciją.

Paskelbtas naujas tyrimas: Pfizer BioNTech COVID-19 mRNA vakcinos BNT162b2 atvirkštinės transkripcijos in vitro žmogaus kepenų ląstelių linijoje.

vakcinos, mRNA vakcinos, DNR

IgorChudov praneša:

Tai reiškia, kad laboratoriniai tyrimai rodo, jog mRNA vakcina DRAUDŽIA integruotis į žmogaus ląstelių DNR. Tai reiškia, kad "Pfizer" vakcinos injekcija, suleista net vieną kartą, visam laikui pakeičia paveiktų ląstelių DNR.

Tačiau bombos formos straipsnyje iš žurnalo Current Issues of Molecular Biology (Dabartiniai molekulinės biologijos klausimai) nurodoma priešingai.

vakcinos, mRNA vakcinos, DNR


Straipsnyje parodoma, kad in vitro, naudojant žmogaus kepenų ląstelių liniją, "Pfizer" mRNA vakcina naudoja natūralų atvirkštinės transkriptazės fermentą, vadinamą LINE-1, ir vakcinos genetinis kodas atvirkštine kryptimi perrašomas į DNR.

Jame taip pat paaiškinama, kad vakcinos mRNA iš tikrųjų patenka į kepenis, kurios yra viena iš pageidaujamų vietų (kitos vietos, kaip girdėjome, yra kiaušidės ir kt.).

Ką tai reiškia? Paprastai mūsų ląstelės elgiasi priešingai: ląstelės branduolys, kuriame yra DNR, išreiškia tam tikrą DNR kodą pagal ląstelės sąlygas ir gamina natūralią, žmogaus pasiuntinių RNR. Ši pasiuntinių RNR keliauja iš branduolio, kur išreiškiama į baltymus, reikalingus ląstelės statybai. Taip augantys organizmai išreiškia skirtingas genetines programas, kad augtų raumenų ar smegenų ląstelės ir pan.

Šis procesas vadinamas "transkripcija".

Daugelį metų Centrinė molekulinės biologijos dogma teigė, kad "atvirkštinė transkripcija" - genetinio kodo perkėlimas iš RNR atgal į šventąjį ląstelės branduolį ir DNR perkodavimas - yra neįmanoma. Ilgainiui mokslininkai suprato, kad įvairiomis sąlygomis tai įmanoma. Pavyzdžiui, ŽIV RNR virusas tai sugeba ir perprogramuoja mūsų DNR taip, kad ši gamintų jo kopijas. ŽIV yra virusas, sukeliantis AIDS.

Atvirkštinei transkripcijai atlikti reikalingi fermentai, vadinami "atvirkštinėmis transkriptazėmis". Vienas iš jų vadinamas LINE-1.

Akivaizdu, kad, remiantis tyrimais, "Pfizer" mRNA vakcina priverčia ląsteles gaminti tą LINE-1 fermentą.

vakcinos, mRNA vakcinos, DNR

Pastebėję, kad LINE-1 atvirkštinės transkriptazės kiekis padidėja, jie ištyrė, ar nėra DNR pakitimų, kad įsitikintų, jog vietoj jos neperima RNR.

vakcinos, mRNA vakcinos, DNR

Genetinis kodas, kurį jie užfiksavo, yra toks:

CGAGGTGGGGCCAAGAATCTGAACGAGA
GCCTGATCGACCTGCAAGAACTGGGGAAGT ACGAGCAGCAGTACATCAAGTGGCCCTGGTACA
TCTGGCTGCTTTATCGCCGGACTGATTG CCATCGTGATGGTCACAATCATGCTGTGTT
GCATGACCAGCTGCTGTAGCTGCTGCTGAAGG GCTGTTGTAGCTGTGGCAGCTGCTGCTGCAAGT
TCGACGAGGACGACGATTCTGAGCCCGTGCTGA
AGGGCGTGAAACTGCACTACACACATGATGAC
TCGAGCTGGTACTGCATGCACGCAATGCTA GCTGCCCCTTTCCCGTCCTGGGTACCCCGA
GTCTCCCCCCCGACCTGGTGTCCCCAGGTATGC TCCCACCTCCACCTGCCCCCCACTCACCACCT
CTGCTAGTTCCAGACACCTCCCCCAAGCACGC AGCAATGCAGCTCAAAACGCTTAGCCTA

Ar kas nors norėtų atlikti BLAST paiešką?

Supaprastintas

Kaip paaiškinau atsakydamas į vieną klausimą:

Pfizer mRNA vakcina keičia mūsų genetinį kodą, kuris lemia, kaip veikia mūsų organizmai, ir kurį paveldėjote iš savo mamos ir tėčio. Dabar jūsų DNR buvo pakeista nuo tos, kurią jums davė mama ir tėtis, pridedant mažą paslaptingą "Pfizer" "redagavimą".

Jūsų organizmas veikia pagal jūsų DNR programą, o dabar, na, tą programą nulaužė ir pakeitė "Pfizer".

Vėžio kodas

Atsižvelgiant į tai, kad "Sars-Cov-2" "spyglio baltymas" turi vėžio kodą iš "Moderna 2017" patento 9 587 003, būtina išsiaiškinti šios atvirkštinės transkripcijos pasekmes ir tai, ar paskiepytieji dabar turi kokį nors nepageidaujamą genetinį kodą, įterptą į jų DNR.

Ypač įdomu, ar ši mRNA sukelta atvirkštinė transkripcija veikia "lytinę liniją", pavyzdžiui, kiaušinėlius ir spermatozoidus, ir ar ji taip pat veikia nėščių motinų vaisius.

Prašome pakartotinai plačiai paskelbti šį straipsnį dėl jo didelės reikšmės mūsų visuomenės sveikatai.

EDIT: Mūsų įžvalgus komentatorius atkreipė dėmesį į anoniminį 4chan įrašą, parašytą 2020 m. gruodį, gerokai anksčiau, nei visa tai tapo žinoma. Ši data verčia mus visus paklausti, ar šis asmuo žinojo per daug?

vakcinos, mRNA vakcinos, DNR

Naujausias Pasaulio naujienas kitaip... skaitykite Paranormal Telegram kanale. Jei manai, kad mano darbas yra naudingas, pasidalink, prenumeruok, padėkok ar paremk...

Niekas neišdrįso palikti komentaro. Registruokitės.
Būkite pirmi, kurie pasidalins savo nuomonėmis su kitais. Prisjungus galite komentuoti anonimiškai, po komentaro apačioje paspaudę Anonimas. Nepykite komentatoriai, bet komentarai su keiksmažodžiais bus šalinami automatiškai, be atsiprašymo.
avatar
PASKUTINĖS NAUJIENOS:
03.07.2022 laikas 21:13 Mokslininkai įspėja, kad dirvožemis staiga sukelia "žudikišką" širdies ligą

Mokslininkai įspėja sodininkus, kad dirvožemyje randama paslaptinga medžiaga sukelia staigų širdies ligų protrūkį.

Skaityti daugiau

03.07.2022 laikas 17:58 Singapūro alaus darykla pristato naują alų, pagamintą iš perdirbto nuotekų vandens

Kaip sunkiai klostosi situacija pasaulyje? Ką gi, Singapūre pradedamas gaminti naujas "susižavėjimo vertas" alus, gaminamas iš "perdirbtų nuotekų".

Skaityti daugiau

03.07.2022 laikas 14:57 Sietlo policija pradėjo areštuoti žmones, kurie viešai skaito Bibliją

Sietlo policija pradėjo areštuoti žmones, kurie viešai skaito Bibliją, nes tai gali įžeisti LGBTQ+ bendruomenės narius

Skaityti daugiau

03.07.2022 laikas 13:52 Prancūzijos vyriausybė "rekomenduoja" žmonėms vėl pradėti dėvėti veido kaukes ir svarsto dar vieną įpareigojimą
Prancūzijos vyriausybės pareigūnai pradėjo "kviesti" arba "rekomenduoti" žmonėms vėl dėvėti veido kaukes, nes sergančiųjų kokliušu* skaičius pradeda augti.

Skaityti daugiau

03.07.2022 laikas 13:34 Honkongo įstatymų leidėjo Covid testas po nuotraukos su Xi teigiamas
Honkongo įstatymų leidėjas, kuris pozavo bendrai nuotraukai su Kinijos prezidentu Xi Jinpingu (Xi Jinping) per šią savaitę vykusį šalies vadovo vizitą į šį finansų centrą, sekmadienį patvirtino, kad jo koronaviruso testas buvo teigiamas....

Skaityti daugiau

03.07.2022 laikas 08:11 Receptai | Patiekalai Orkaitėje keptas karpis gabaliukais su bulvėmis ir daržovėmis
Jei jau kalbėti apie žuvis, visada mano didžiausiais favoritais būdavo upėtakis, lašiša arba dorada. Karpį buvau jau ganėtinai senokai buvau primiršusi.

Skaityti daugiau

02.07.2022 laikas 22:16 Receptai | Patiekalai Virta kepta karka orkaitėje su raugintais kopūstais
Ar mėgstate ruošti kiaulienos karką? Man asmeniškai tai vienas skaniausių patiekalų iš kiaulienos, kurį galėčiau valgyti, kad ir kasdien.

Skaityti daugiau

02.07.2022 laikas 14:01 Receptai | Patiekalai Skaniai keptas upėtakis ant grotelių su petražolėmis ir citrina

Greitai pagaminamas, lengvas, fantastiško skonio kepto upėtakio ant grotelių patiekalas. Man šitaip skaniai paruošta žuvis yra kažkas tokio. Atrodo, kad galėčiau valgyti tiesiog nesustodama.

Skaityti daugiau